gcggauuuagcucaguugggagagcgccggucuccaaaaccggagguccuguguucgauccacagaauucgcacca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4cxg:Y | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 4cxh:Y |
2 | 4v4i:0 | 76 | 76 | 0.9211 | 0.9211 | 0.9211 | 4.51e-25 | 4v4j:2 |
3 | 1ob2:B | 76 | 76 | 0.9079 | 0.9079 | 0.9079 | 2.10e-23 | |
4 | 8ccs:Bb | 76 | 76 | 0.9079 | 0.9079 | 0.9079 | 2.10e-23 | 8cdl:Bb, 8cdr:Bb, 8ceh:Bb, 8cf5:Bb, 8cg8:Bb, 8civ:Bb, 8cku:Bb, 3deg:A, 6gq1:AX, 6gqb:AX, 6gqv:AY, 3izy:N, 5m1j:A3, 1mj1:D, 1ml5:B, 1sz1:E, 1sz1:F, 1ttt:D, 1ttt:E, 1ttt:F, 4v49:AV, 4v4p:BB, 4v4p:BC, 4v4r:AV, 4v4r:AW, 4v4s:AV, 4v4s:AW, 4v4t:AV, 4v4t:AW, 4v4v:AU, 4v4v:AV, 4v4v:AW, 4v4w:AW, 4v65:AE, 4v66:AE, 4v69:AY, 4v7h:A7, 6xiq:AX, 6xz7:g, 6xzb:g2 |
5 | 4v65:AA | 75 | 75 | 0.8947 | 0.9067 | 0.9067 | 7.55e-23 | 4v65:AP, 4v66:AP |
6 | 1ob5:B | 76 | 74 | 0.8816 | 0.8816 | 0.9054 | 2.71e-22 | 1ob5:D, 1ob5:F |
7 | 8cth:C | 74 | 74 | 0.8816 | 0.9054 | 0.9054 | 2.71e-22 | |
8 | 6xir:AZ | 73 | 73 | 0.8684 | 0.9041 | 0.9041 | 9.76e-22 | |
9 | 6ah3:T | 80 | 73 | 0.8684 | 0.8250 | 0.9041 | 9.76e-22 | |
10 | 6lvr:D | 72 | 72 | 0.8553 | 0.9028 | 0.9028 | 3.51e-21 | 6lvr:B |
11 | 3wc2:P | 74 | 74 | 0.8684 | 0.8919 | 0.8919 | 1.26e-20 | |
12 | 3wc2:Q | 73 | 73 | 0.8553 | 0.8904 | 0.8904 | 4.54e-20 | |
13 | 4v68:AY | 72 | 76 | 0.8553 | 0.9028 | 0.8553 | 1.27e-15 | |
14 | 8bsj:x | 74 | 78 | 0.8684 | 0.8919 | 0.8462 | 1.65e-14 | |
15 | 3icq:D | 62 | 36 | 0.4737 | 0.5806 | 1.0000 | 7.66e-13 | |
16 | 3icq:E | 62 | 34 | 0.4474 | 0.5484 | 1.0000 | 9.90e-12 |