BioLiP

>rna
gcggauuuaacucaguugggagagcgccgagguccuguguucgauccacagaauucgcacca

The query sequence (length=62) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	3icq:E	62	62	1.0000	1.0000	1.0000	2.08e-27
2	3icq:D	62	62	0.9839	0.9839	0.9839	9.70e-26
3	4v68:AY	72	34	0.5484	0.4722	1.0000	7.66e-12
4	4v4i:0	76	34	0.5484	0.4474	1.0000	7.66e-12	4v4j:2
5	1ob2:B	76	34	0.5484	0.4474	1.0000	7.66e-12
6	4cxg:Y	76	34	0.5484	0.4474	1.0000	7.66e-12	4cxh:Y
7	8ccs:Bb	76	34	0.5484	0.4474	1.0000	7.66e-12	8cdl:Bb, 8cdr:Bb, 8ceh:Bb, 8cf5:Bb, 8cg8:Bb, 8civ:Bb, 8cku:Bb, 3deg:A, 6gq1:AX, 6gqb:AX, 6gqv:AY, 3izy:N, 5m1j:A3, 1mj1:D, 1ml5:B, 1sz1:E, 1sz1:F, 1ttt:D, 1ttt:E, 1ttt:F, 4v49:AV, 4v4p:BB, 4v4p:BC, 4v4r:AV, 4v4r:AW, 4v4s:AV, 4v4s:AW, 4v4t:AV, 4v4t:AW, 4v4v:AU, 4v4v:AV, 4v4v:AW, 4v4w:AW, 4v65:AE, 4v66:AE, 4v69:AY, 4v7h:A7, 6xiq:AX, 6xz7:g, 6xzb:g2
8	4v65:AA	75	33	0.5323	0.4400	1.0000	2.75e-11	4v65:AP, 4v66:AP
9	3wc2:P	74	32	0.5161	0.4324	1.0000	9.91e-11
10	1ob5:B	76	32	0.5161	0.4211	1.0000	9.91e-11	1ob5:D, 1ob5:F
11	8cth:C	74	32	0.5161	0.4324	1.0000	9.91e-11
12	6xir:AZ	73	31	0.5000	0.4247	1.0000	3.56e-10
13	3wc2:Q	73	31	0.5000	0.4247	1.0000	3.56e-10
14	8bsj:x	74	31	0.5000	0.4189	1.0000	3.56e-10
15	6ah3:T	80	31	0.5000	0.3875	1.0000	3.56e-10
16	6lvr:D	72	30	0.4839	0.4167	1.0000	1.28e-09	6lvr:B

[Back]