gcgccgcugguguagugguaucaugcaagauucccauucuugcgacccggguucgauucccgggcggcgc
The query sequence (length=70) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4kr3:C | 70 | 70 | 1.0000 | 1.0000 | 1.0000 | 8.61e-32 | |
2 | 5e6m:C | 74 | 70 | 1.0000 | 0.9459 | 1.0000 | 8.61e-32 | 5e6m:E |
3 | 4kr2:C | 69 | 69 | 0.9857 | 1.0000 | 1.0000 | 3.10e-31 | 4qei:C |