gcgccgcugguguagugguaucaugcaagauucccauucuugcgacccggguucgauucccgggcggcg
The query sequence (length=69) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4kr3:C | 70 | 69 | 1.0000 | 0.9857 | 1.0000 | 3.04e-31 | |
| 2 | 4kr2:C | 69 | 69 | 1.0000 | 1.0000 | 1.0000 | 3.04e-31 | 4qei:C |
| 3 | 5e6m:C | 74 | 69 | 1.0000 | 0.9324 | 1.0000 | 3.04e-31 | 5e6m:E |
umich.edu