gcgagcaaugaugagugaugggcgaacugagcucgaaagagcaaugaugagugaugggcgaacugagcucgc
The query sequence (length=72) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4by9:A | 72 | 72 | 1.0000 | 1.0000 | 1.0000 | 6.92e-33 | 4by9:B |
| 2 | 4by9:A | 72 | 33 | 0.4583 | 0.4583 | 1.0000 | 3.31e-11 | 4by9:B |
| 3 | 4by9:A | 72 | 33 | 0.4583 | 0.4583 | 1.0000 | 3.31e-11 | 4by9:B |
umich.edu