BioLiP

>rna
gccggcuaagaucaaguguaguaucuguucuuaucaguuuaauaucugauuccucgaggaggauuuuuggagcagggaga
uggaauaggagcuugcuccguccacuccacgcaucgaccugguauugcaguaccuccaggaacggugc

The query sequence (length=148) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7evo:H	148	148	1.0000	1.0000	1.0000	9.42e-75	8hk1:H, 6y5q:2
2	7abi:2	164	148	0.9797	0.8841	0.9797	1.23e-68
3	8i0r:H	167	149	0.9797	0.8683	0.9732	1.59e-67	8i0s:H, 8i0t:H, 8i0u:H
4	8i0p:H	165	149	0.9797	0.8788	0.9732	1.59e-67
5	7vpx:H	130	130	0.8784	1.0000	1.0000	9.55e-65
6	7abg:2	145	134	0.8716	0.8897	0.9627	1.61e-57
7	8i0v:H	151	145	0.8986	0.8808	0.9172	9.76e-50
8	6y53:2	98	98	0.6622	1.0000	1.0000	5.87e-47
9	7a5p:2	155	88	0.5946	0.5677	1.0000	2.13e-41
10	5z56:H	136	83	0.5338	0.5809	0.9518	7.76e-31	5z57:H, 5z58:H
11	5z56:H	136	42	0.2838	0.3088	1.0000	7.93e-16	5z57:H, 5z58:H
12	8ch6:f	137	84	0.5338	0.5766	0.9405	3.61e-29
13	8ch6:f	137	42	0.2838	0.3066	1.0000	7.93e-16
14	5mqf:2	140	145	0.8108	0.8571	0.8276	2.81e-25
15	8c6j:2	142	145	0.8108	0.8451	0.8276	2.81e-25
16	6y50:2	50	50	0.3378	1.0000	1.0000	2.83e-20
17	7qtt:f	76	57	0.3716	0.7237	0.9649	2.83e-20
18	5o9z:2	100	48	0.3243	0.4800	1.0000	3.66e-19
19	6icz:H	140	42	0.2838	0.3000	1.0000	7.93e-16	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
20	6icz:H	140	29	0.1959	0.2071	1.0000	1.34e-08	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
21	8i0w:H	139	42	0.2838	0.3022	1.0000	7.93e-16	5yzg:H
22	8i0w:H	139	29	0.1959	0.2086	1.0000	1.34e-08	5yzg:H
23	9fmd:2	120	42	0.2838	0.3500	1.0000	7.93e-16	6qdv:2
24	9fmd:2	120	38	0.2568	0.3167	1.0000	1.33e-13	6qdv:2
25	6ah0:H	109	42	0.2838	0.3853	1.0000	7.93e-16	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
26	6ah0:H	109	36	0.2432	0.3303	1.0000	1.72e-12	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
27	8r09:2	98	38	0.2568	0.3878	1.0000	1.33e-13	8r0b:2, 8rm5:2
28	8r09:2	98	38	0.2568	0.3878	1.0000	1.33e-13	8r0b:2, 8rm5:2
29	8r08:2	97	38	0.2568	0.3918	1.0000	1.33e-13	8r0a:2
30	8r08:2	97	38	0.2568	0.3918	1.0000	1.33e-13	8r0a:2
31	8qxd:2	97	38	0.2568	0.3918	1.0000	1.33e-13
32	8qxd:2	97	38	0.2568	0.3918	1.0000	1.33e-13
33	6qx9:2	94	38	0.2568	0.4043	1.0000	1.33e-13
34	6qx9:2	94	34	0.2297	0.3617	1.0000	2.22e-11
35	8qo9:2	98	38	0.2568	0.3878	1.0000	1.33e-13	8qzs:2
36	8qo9:2	98	38	0.2568	0.3878	1.0000	1.33e-13	8qzs:2
37	6id1:H	136	38	0.2568	0.2794	1.0000	1.33e-13
38	6id1:H	136	29	0.1959	0.2132	1.0000	1.34e-08
39	6id0:H	140	38	0.2568	0.2714	1.0000	1.33e-13
40	6id0:H	140	43	0.2770	0.2929	0.9535	1.72e-12
41	7abh:2	37	37	0.2500	1.0000	1.0000	4.77e-13
42	7q4o:2	35	35	0.2365	1.0000	1.0000	6.17e-12
43	7onb:H	32	32	0.2162	1.0000	1.0000	2.87e-10
44	7q4p:2	45	31	0.2095	0.6889	1.0000	1.03e-09

[Back]