BioLiP

>rna
gccggcuaagaucaaguguaguaucuguucuuaucaguuuaauaucugau

The query sequence (length=50) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5z56:H	136	50	1.0000	0.3676	1.0000	7.10e-21	5z57:H, 5z58:H
2	6y50:2	50	50	1.0000	1.0000	1.0000	7.10e-21
3	7evo:H	148	50	1.0000	0.3378	1.0000	7.10e-21	8hk1:H, 6y5q:2
4	7qtt:f	76	51	1.0000	0.6579	0.9804	3.30e-19
5	8i0r:H	167	47	0.9400	0.2814	1.0000	3.30e-19	8i0s:H, 8i0t:H, 8i0u:H
6	8i0p:H	165	47	0.9400	0.2848	1.0000	3.30e-19
7	8ch6:f	137	51	1.0000	0.3650	0.9804	3.30e-19
8	7abi:2	164	47	0.9400	0.2866	1.0000	3.30e-19
9	5mqf:2	140	42	0.8400	0.3000	1.0000	1.99e-16
10	9fmd:2	120	42	0.8400	0.3500	1.0000	1.99e-16	6qdv:2
11	8c6j:2	142	42	0.8400	0.2958	1.0000	1.99e-16
12	8r09:2	98	38	0.7600	0.3878	1.0000	3.33e-14	8r0b:2, 8rm5:2
13	8r08:2	97	38	0.7600	0.3918	1.0000	3.33e-14	8r0a:2
14	8qxd:2	97	38	0.7600	0.3918	1.0000	3.33e-14
15	8qo9:2	98	38	0.7600	0.3878	1.0000	3.33e-14	8qzs:2
16	7abh:2	37	37	0.7400	1.0000	1.0000	1.20e-13
17	6id0:H	140	43	0.8200	0.2929	0.9535	4.31e-13
18	6ah0:H	109	36	0.7200	0.3303	1.0000	4.31e-13	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
19	7q4o:2	35	35	0.7000	1.0000	1.0000	1.55e-12
20	6qx9:2	94	34	0.6800	0.3617	1.0000	5.57e-12
21	7vpx:H	130	32	0.6400	0.2462	1.0000	7.20e-11
22	7onb:H	32	32	0.6400	1.0000	1.0000	7.20e-11
23	7q4p:2	45	31	0.6200	0.6889	1.0000	2.59e-10
24	6id1:H	136	29	0.5800	0.2132	1.0000	3.35e-09
25	6icz:H	140	29	0.5800	0.2071	1.0000	3.35e-09	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
26	8i0w:H	139	29	0.5800	0.2086	1.0000	3.35e-09	5yzg:H

[Back]