gccgagguagcucaguugguagagcaugcgacugaaaaucgcagugucggcgguucgauucugcuccucggcac
The query sequence (length=74) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 3tup:T | 74 | 74 | 1.0000 | 1.0000 | 1.0000 | 5.55e-34 | |
2 | 4v4x:AD | 76 | 74 | 0.9865 | 0.9605 | 0.9865 | 2.58e-32 | 4v4z:AD |
3 | 3b0v:A | 73 | 73 | 0.9595 | 0.9726 | 0.9726 | 4.32e-30 | 3b0v:B |
4 | 1eiy:C | 76 | 74 | 0.9595 | 0.9342 | 0.9595 | 5.59e-29 | 2iy5:T |