gcccggaugguggaaucgguagacacaagggauucccucggcgcgcgcugugcggguucaagucccgcuccggguacca
The query sequence (length=79) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4aq7:B | 79 | 79 | 1.0000 | 1.0000 | 1.0000 | 1.01e-36 | 4cqn:E, 5on3:B, 5on3:E |
2 | 3zgz:E | 80 | 79 | 0.9873 | 0.9750 | 0.9873 | 4.68e-35 | |
3 | 5on2:E | 81 | 81 | 1.0000 | 0.9753 | 0.9753 | 6.06e-34 | |
4 | 4aq7:E | 77 | 79 | 0.9747 | 1.0000 | 0.9747 | 7.83e-33 | 5omw:E |
5 | 3zgz:B | 82 | 81 | 0.9873 | 0.9512 | 0.9630 | 2.82e-32 | |
6 | 4cqn:B | 82 | 82 | 1.0000 | 0.9634 | 0.9634 | 2.82e-32 | 5onh:B |
7 | 4ari:B | 80 | 81 | 0.9873 | 0.9750 | 0.9630 | 1.01e-31 | 3zju:B |
8 | 5onh:E | 83 | 83 | 1.0000 | 0.9518 | 0.9518 | 3.64e-31 | |
9 | 5omw:B | 83 | 83 | 1.0000 | 0.9518 | 0.9518 | 3.64e-31 | |
10 | 3zjt:B | 83 | 82 | 0.9873 | 0.9398 | 0.9512 | 1.31e-30 | |
11 | 4as1:B | 83 | 83 | 0.9873 | 0.9398 | 0.9398 | 1.70e-29 | |
12 | 3zjv:B | 85 | 85 | 1.0000 | 0.9294 | 0.9294 | 2.19e-28 | |
13 | 5on2:B | 85 | 85 | 1.0000 | 0.9294 | 0.9294 | 2.19e-28 | |
14 | 8pot:B | 84 | 84 | 0.9873 | 0.9286 | 0.9286 | 7.89e-28 | |
15 | 4arc:B | 71 | 69 | 0.8354 | 0.9296 | 0.9565 | 4.75e-25 | |
16 | 2nqp:F | 71 | 73 | 0.8608 | 0.9577 | 0.9315 | 6.14e-24 |