gcccggaugguggaaucgguagacacaagggauuaaucccucggcgcgcgcugugcggguucaagucccgcuccggguac
ca
The query sequence (length=82) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4cqn:B | 82 | 82 | 1.0000 | 1.0000 | 1.0000 | 2.27e-38 | 5onh:B |
2 | 5omw:B | 83 | 83 | 1.0000 | 0.9880 | 0.9880 | 1.06e-36 | |
3 | 5on2:E | 81 | 82 | 0.9878 | 1.0000 | 0.9878 | 3.80e-36 | |
4 | 3zjv:B | 85 | 85 | 1.0000 | 0.9647 | 0.9647 | 6.36e-34 | |
5 | 5on2:B | 85 | 85 | 1.0000 | 0.9647 | 0.9647 | 6.36e-34 | |
6 | 8pot:B | 84 | 84 | 0.9878 | 0.9643 | 0.9643 | 2.29e-33 | |
7 | 5onh:E | 83 | 84 | 0.9878 | 0.9759 | 0.9643 | 2.29e-33 | |
8 | 4aq7:B | 79 | 82 | 0.9634 | 1.0000 | 0.9634 | 2.96e-32 | 4cqn:E, 5on3:B, 5on3:E |
9 | 4as1:B | 83 | 84 | 0.9756 | 0.9639 | 0.9524 | 1.06e-31 | |
10 | 3zgz:E | 80 | 82 | 0.9512 | 0.9750 | 0.9512 | 1.38e-30 | |
11 | 3zjt:B | 83 | 84 | 0.9634 | 0.9518 | 0.9405 | 4.95e-30 | |
12 | 4aq7:E | 77 | 82 | 0.9390 | 1.0000 | 0.9390 | 2.30e-28 | 5omw:E |
13 | 3zgz:B | 82 | 84 | 0.9512 | 0.9512 | 0.9286 | 8.28e-28 | |
14 | 4ari:B | 80 | 84 | 0.9512 | 0.9750 | 0.9286 | 8.28e-28 | 3zju:B |
15 | 2nqp:F | 71 | 74 | 0.8537 | 0.9859 | 0.9459 | 3.85e-26 | |
16 | 4arc:B | 71 | 72 | 0.8049 | 0.9296 | 0.9167 | 3.88e-21 |