gcccggaugguggaaucgguagacacaagggauuaaaucccucggcguucgcgcugugcggguucaagucccgcuccggg
uacca
The query sequence (length=85) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 3zjv:B | 85 | 85 | 1.0000 | 1.0000 | 1.0000 | 5.11e-40 | |
2 | 8pot:B | 84 | 84 | 0.9882 | 1.0000 | 1.0000 | 1.84e-39 | |
3 | 5onh:E | 83 | 85 | 0.9765 | 1.0000 | 0.9765 | 3.98e-36 | |
4 | 5omw:B | 83 | 85 | 0.9765 | 1.0000 | 0.9765 | 3.98e-36 | |
5 | 4as1:B | 83 | 85 | 0.9765 | 1.0000 | 0.9765 | 3.98e-36 | |
6 | 4cqn:B | 82 | 85 | 0.9647 | 1.0000 | 0.9647 | 6.66e-34 | 5onh:B |
7 | 5on2:B | 85 | 87 | 0.9765 | 0.9765 | 0.9540 | 2.40e-33 | |
8 | 3zjt:B | 83 | 85 | 0.9529 | 0.9759 | 0.9529 | 3.10e-32 | |
9 | 5on2:E | 81 | 85 | 0.9529 | 1.0000 | 0.9529 | 3.10e-32 | |
10 | 3zgz:B | 82 | 85 | 0.9412 | 0.9756 | 0.9412 | 1.44e-30 | |
11 | 4ari:B | 80 | 85 | 0.9412 | 1.0000 | 0.9412 | 5.19e-30 | 3zju:B |
12 | 4aq7:B | 79 | 85 | 0.9294 | 1.0000 | 0.9294 | 2.41e-28 | 4cqn:E, 5on3:B, 5on3:E |
13 | 3zgz:E | 80 | 85 | 0.9176 | 0.9750 | 0.9176 | 1.12e-26 | |
14 | 4aq7:E | 77 | 85 | 0.9059 | 1.0000 | 0.9059 | 1.88e-24 | 5omw:E |
15 | 2nqp:F | 71 | 77 | 0.8353 | 1.0000 | 0.9221 | 6.76e-24 | |
16 | 4arc:B | 71 | 73 | 0.8000 | 0.9577 | 0.9315 | 2.43e-23 |