gcccggaugguggaaucgguagacacaagggauaaucccucggcguucgcgcugugcggguucaagucccgcuccgggua
cca
The query sequence (length=83) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5onh:E | 83 | 83 | 1.0000 | 1.0000 | 1.0000 | 6.41e-39 | |
2 | 4as1:B | 83 | 83 | 0.9880 | 0.9880 | 0.9880 | 2.98e-37 | |
3 | 3zjv:B | 85 | 85 | 1.0000 | 0.9765 | 0.9765 | 3.86e-36 | |
4 | 8pot:B | 84 | 84 | 0.9880 | 0.9762 | 0.9762 | 1.39e-35 | |
5 | 3zjt:B | 83 | 83 | 0.9759 | 0.9759 | 0.9759 | 4.99e-35 | |
6 | 5on2:E | 81 | 83 | 0.9759 | 1.0000 | 0.9759 | 4.99e-35 | |
7 | 3zgz:B | 82 | 83 | 0.9639 | 0.9756 | 0.9639 | 2.32e-33 | |
8 | 4cqn:B | 82 | 84 | 0.9759 | 0.9878 | 0.9643 | 2.32e-33 | 5onh:B |
9 | 4ari:B | 80 | 83 | 0.9639 | 1.0000 | 0.9639 | 8.36e-33 | 3zju:B |
10 | 5omw:B | 83 | 85 | 0.9759 | 0.9759 | 0.9529 | 3.01e-32 | |
11 | 4aq7:B | 79 | 83 | 0.9518 | 1.0000 | 0.9518 | 3.89e-31 | 4cqn:E, 5on3:B, 5on3:E |
12 | 3zgz:E | 80 | 83 | 0.9398 | 0.9750 | 0.9398 | 1.81e-29 | |
13 | 5on2:B | 85 | 87 | 0.9759 | 0.9529 | 0.9310 | 1.81e-29 | |
14 | 4aq7:E | 77 | 83 | 0.9277 | 1.0000 | 0.9277 | 3.03e-27 | 5omw:E |
15 | 2nqp:F | 71 | 75 | 0.8554 | 1.0000 | 0.9467 | 1.09e-26 | |
16 | 4arc:B | 71 | 71 | 0.8193 | 0.9577 | 0.9577 | 3.92e-26 |