gcccggaugauccucaguggucuggggugcagaccuguugucucgacagagugguucaauuccaccuuucgggcg
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4zdo:E | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | |
| 2 | 4zdp:E | 74 | 77 | 0.9600 | 0.9730 | 0.9351 | 1.23e-25 | |
| 3 | 3hl2:E | 82 | 80 | 0.9867 | 0.9024 | 0.9250 | 1.23e-25 | |
| 4 | 7mdl:E | 84 | 82 | 1.0000 | 0.8929 | 0.9146 | 1.59e-24 | |
| 5 | 8g9z:E | 87 | 85 | 1.0000 | 0.8621 | 0.8824 | 1.24e-20 | |
| 6 | 4rqe:B | 84 | 82 | 0.9600 | 0.8571 | 0.8780 | 5.77e-19 | |
| 7 | 4rqe:D | 83 | 81 | 0.9467 | 0.8554 | 0.8765 | 2.08e-18 | |
| 8 | 7zjw:F | 90 | 87 | 1.0000 | 0.8333 | 0.8621 | 7.47e-18 |
umich.edu