gccaggguggcagaggggcuuugcggcggacucuagauccgcuuuaccccgguucgaauccgggcccuggc
The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 2du6:D | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 2.44e-32 | |
| 2 | 2du5:D | 71 | 71 | 0.9718 | 0.9718 | 0.9718 | 5.29e-29 | |
| 3 | 2du3:D | 71 | 71 | 0.9718 | 0.9718 | 0.9718 | 5.29e-29 | 2du4:C |
umich.edu