gcauugcuggugcagcgcagcgcggacgcccgaaccuggucagagccggaaggcagcagccauaagggaugcuuugcggg
ugccguugccuuccggcaaugc
The query sequence (length=102) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 2xxa:F | 102 | 102 | 1.0000 | 1.0000 | 1.0000 | 2.28e-49 | 2xxa:G |
| 2 | 3zn8:G | 88 | 88 | 0.8627 | 1.0000 | 1.0000 | 1.38e-41 | |
| 3 | 5aka:7 | 74 | 74 | 0.7255 | 1.0000 | 1.0000 | 8.38e-34 |
umich.edu