gaugcuuacuuagucaucugguuggcaaaccuccgcggaccuucgggaccaauggagaggaacccagccgagaagcaucg
agcgcucugacacca
The query sequence (length=95) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8i3q:C | 95 | 95 | 1.0000 | 1.0000 | 1.0000 | 1.63e-45 | |
| 2 | 6xmg:C | 130 | 83 | 0.8737 | 0.6385 | 1.0000 | 7.62e-39 | |
| 3 | 6xmf:C | 109 | 83 | 0.8737 | 0.7615 | 1.0000 | 7.62e-39 |
umich.edu