BioLiP

>rna
gauaacucaauuuguaaaaaaguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaag
uga

The query sequence (length=83) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5fq5:A	83	83	1.0000	1.0000	1.0000	6.41e-39
2	4un4:A	82	82	0.9880	1.0000	1.0000	2.31e-38	4un5:A
3	6k4p:A	82	81	0.9759	0.9878	1.0000	8.30e-38
4	5fw1:A	81	81	0.9759	1.0000	1.0000	8.30e-38	5fw2:A, 5fw3:A, 6k3z:A, 6k4q:A, 6k57:A, 4un3:A
5	6k4s:A	80	80	0.9639	1.0000	1.0000	2.98e-37	6k4u:A
6	6aeb:A	95	79	0.9518	0.8316	1.0000	1.07e-36	6aeb:E, 6aeg:A
7	5vw1:C	73	71	0.8554	0.9726	1.0000	3.01e-32
8	7zo1:A	85	63	0.7590	0.7412	1.0000	8.42e-28
9	7s38:R	87	63	0.7590	0.7241	1.0000	8.42e-28
10	7qr1:A	83	63	0.7590	0.7590	1.0000	8.42e-28
11	7qr0:A	82	63	0.7590	0.7683	1.0000	8.42e-28
12	7ox8:A	84	63	0.7590	0.7500	1.0000	8.42e-28
13	7z4d:F	77	62	0.7470	0.8052	1.0000	3.03e-27
14	7z4d:A	75	62	0.7470	0.8267	1.0000	3.03e-27
15	8ygj:B	136	62	0.7470	0.4559	1.0000	3.03e-27
16	8wuv:B	126	62	0.7470	0.4921	1.0000	3.03e-27
17	8wuu:B	111	62	0.7470	0.5586	1.0000	3.03e-27
18	8wut:B	112	62	0.7470	0.5536	1.0000	3.03e-27
19	8wus:B	115	62	0.7470	0.5391	1.0000	3.03e-27
20	6vpc:A	81	62	0.7470	0.7654	1.0000	3.03e-27
21	7qr8:A	85	62	0.7470	0.7294	1.0000	3.03e-27
22	7qqw:A	81	62	0.7470	0.7654	1.0000	3.03e-27
23	7qqv:A	85	62	0.7470	0.7294	1.0000	3.03e-27
24	7qqs:A	84	62	0.7470	0.7381	1.0000	3.03e-27	7qqt:A, 7qqu:A, 7qqx:A, 7qqz:A, 7qr5:A
25	7qqq:A	83	62	0.7470	0.7470	1.0000	3.03e-27
26	7ox9:A	84	62	0.7470	0.7381	1.0000	3.03e-27	7qqo:A, 7qr7:A
27	7ox7:A	81	62	0.7470	0.7654	1.0000	3.03e-27
28	4zt0:B	72	61	0.7349	0.8472	1.0000	1.09e-26	4zt0:D, 4zt9:B, 4zt9:D
29	7z4g:A	91	61	0.7349	0.6703	1.0000	1.09e-26
30	8ye6:C	92	61	0.7349	0.6630	1.0000	1.09e-26	7z4h:A
31	5y36:B	99	61	0.7349	0.6162	1.0000	1.09e-26
32	8t78:B	89	61	0.7349	0.6854	1.0000	1.09e-26
33	8t77:B	89	61	0.7349	0.6854	1.0000	1.09e-26	8t79:B
34	8t6y:B	88	61	0.7349	0.6932	1.0000	1.09e-26
35	8t6t:B	95	61	0.7349	0.6421	1.0000	1.09e-26
36	8t6s:B	90	61	0.7349	0.6778	1.0000	1.09e-26	7z4c:A
37	8t6p:B	88	61	0.7349	0.6932	1.0000	1.09e-26	8t76:B, 8t7s:H, 7z4e:A, 7z4k:A
38	7s4v:B	98	61	0.7349	0.6224	1.0000	1.09e-26	7s4x:B, 8spq:B, 8sqh:B, 8srs:B, 8t7s:B, 8tzz:B, 8u3y:B, 7z4j:A
39	7s4u:B	97	61	0.7349	0.6289	1.0000	1.09e-26
40	7s36:R	87	61	0.7349	0.7011	1.0000	1.09e-26	8t6o:B
41	7qqp:A	84	61	0.7349	0.7262	1.0000	1.09e-26	7qqr:A
42	7oxa:A	81	61	0.7349	0.7531	1.0000	1.09e-26
43	4oo8:B	97	61	0.7349	0.6289	1.0000	1.09e-26	4oo8:E
44	6o0z:B	96	61	0.7349	0.6354	1.0000	1.09e-26	8t6x:B, 7z4i:A, 7z4l:A
45	6o0x:B	98	61	0.7349	0.6224	1.0000	1.09e-26	6o0y:B
46	8kal:E	95	64	0.7590	0.6632	0.9844	1.09e-26
47	8kak:A	94	64	0.7590	0.6702	0.9844	1.09e-26	8kak:E, 8kal:A, 8kam:A
48	8kag:A	98	64	0.7590	0.6429	0.9844	1.09e-26
49	6ifo:D	90	61	0.7349	0.6778	1.0000	1.09e-26
50	6ifo:C	88	61	0.7349	0.6932	1.0000	1.09e-26	5xbl:B
51	8g1i:B	98	61	0.7349	0.6224	1.0000	1.09e-26
52	6ai6:B	81	61	0.7349	0.7531	1.0000	1.09e-26	5b2r:A, 5b2s:A, 5b2t:A
53	8ye9:C	90	61	0.7108	0.6556	0.9672	8.47e-23
54	7v59:C	115	46	0.5542	0.4000	1.0000	2.37e-18	7v59:G
55	8fzt:B	69	46	0.5542	0.6667	1.0000	2.37e-18
56	5f9r:A	116	46	0.5542	0.3966	1.0000	2.37e-18	6mcb:B, 6mcc:B, 5vzl:B
57	8kah:I	63	45	0.5422	0.7143	1.0000	8.53e-18	8kah:J, 8kai:I, 8kai:J, 8kaj:I, 8kaj:J

[Back]