gagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu
The query sequence (length=52) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7w0e:C | 53 | 52 | 1.0000 | 0.9811 | 1.0000 | 5.83e-22 | |
2 | 7w0e:C | 53 | 51 | 0.9808 | 0.9623 | 1.0000 | 2.10e-21 | |
3 | 7w0d:D | 52 | 52 | 1.0000 | 1.0000 | 1.0000 | 5.83e-22 | 7w0d:C, 7w0e:D |
4 | 7w0d:D | 52 | 50 | 0.9615 | 0.9615 | 1.0000 | 7.55e-21 | 7w0d:C, 7w0e:D |
5 | 8hf0:N | 50 | 50 | 0.9615 | 1.0000 | 1.0000 | 7.55e-21 | |
6 | 8hf0:N | 50 | 48 | 0.9231 | 0.9600 | 1.0000 | 9.76e-20 | |
7 | 8hf0:P | 47 | 47 | 0.9038 | 1.0000 | 1.0000 | 3.51e-19 | |
8 | 8hf0:P | 47 | 47 | 0.9038 | 1.0000 | 1.0000 | 3.51e-19 | |
9 | 7w0c:D | 37 | 37 | 0.7115 | 1.0000 | 1.0000 | 1.27e-13 | |
10 | 7w0c:D | 37 | 35 | 0.6731 | 0.9459 | 1.0000 | 1.65e-12 | |
11 | 7w0c:C | 35 | 35 | 0.6731 | 1.0000 | 1.0000 | 1.65e-12 | |
12 | 7w0c:C | 35 | 35 | 0.6731 | 1.0000 | 1.0000 | 1.65e-12 | |
13 | 7w0a:D | 32 | 32 | 0.6154 | 1.0000 | 1.0000 | 7.66e-11 | 7w0a:H |
14 | 7w0a:D | 32 | 30 | 0.5769 | 0.9375 | 1.0000 | 9.90e-10 | 7w0a:H |
15 | 7w0a:C | 31 | 31 | 0.5962 | 1.0000 | 1.0000 | 2.75e-10 | 7w0a:G |
16 | 7w0a:C | 31 | 30 | 0.5769 | 0.9677 | 1.0000 | 9.90e-10 | 7w0a:G |