gagaaugucggggagccgagguugugaauugcuuucaaaaauuuugaaaagcaauucacaauaaggauuauuccguugug
aaaacauucaaggcggggcaacucgccuu
The query sequence (length=109) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8iyq:O | 109 | 109 | 1.0000 | 1.0000 | 1.0000 | 3.18e-53 | 8wmm:D, 8wmm:O, 8wmn:F, 8wmn:O |
| 2 | 8wr4:O | 100 | 96 | 0.8807 | 0.9600 | 1.0000 | 5.35e-46 | |
| 3 | 8wr4:N | 103 | 96 | 0.8807 | 0.9320 | 1.0000 | 5.35e-46 | |
| 4 | 8wmh:O | 89 | 97 | 0.8165 | 1.0000 | 0.9175 | 5.47e-31 |
umich.edu