gacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu
The query sequence (length=50) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7w0e:C | 53 | 50 | 1.0000 | 0.9434 | 1.0000 | 7.10e-21 | |
2 | 7w0e:C | 53 | 49 | 0.9800 | 0.9245 | 1.0000 | 2.55e-20 | |
3 | 7w0d:D | 52 | 50 | 1.0000 | 0.9615 | 1.0000 | 7.10e-21 | 7w0d:C, 7w0e:D |
4 | 7w0d:D | 52 | 48 | 0.9600 | 0.9231 | 1.0000 | 9.19e-20 | 7w0d:C, 7w0e:D |
5 | 8hf0:N | 50 | 50 | 1.0000 | 1.0000 | 1.0000 | 7.10e-21 | |
6 | 8hf0:N | 50 | 46 | 0.9200 | 0.9200 | 1.0000 | 1.19e-18 | |
7 | 8hf0:P | 47 | 47 | 0.9400 | 1.0000 | 1.0000 | 3.30e-19 | |
8 | 8hf0:P | 47 | 45 | 0.9000 | 0.9574 | 1.0000 | 4.28e-18 | |
9 | 7w0c:D | 37 | 37 | 0.7400 | 1.0000 | 1.0000 | 1.20e-13 | |
10 | 7w0c:D | 37 | 33 | 0.6600 | 0.8919 | 1.0000 | 2.00e-11 | |
11 | 7w0c:C | 35 | 35 | 0.7000 | 1.0000 | 1.0000 | 1.55e-12 | |
12 | 7w0c:C | 35 | 33 | 0.6600 | 0.9429 | 1.0000 | 2.00e-11 | |
13 | 7w0a:D | 32 | 32 | 0.6400 | 1.0000 | 1.0000 | 7.20e-11 | 7w0a:H |
14 | 7w0a:D | 32 | 28 | 0.5600 | 0.8750 | 1.0000 | 1.21e-08 | 7w0a:H |
15 | 7w0a:C | 31 | 31 | 0.6200 | 1.0000 | 1.0000 | 2.59e-10 | 7w0a:G |
16 | 7w0a:C | 31 | 28 | 0.5600 | 0.9032 | 1.0000 | 1.21e-08 | 7w0a:G |