gacuauacuuucagggaucauaguguguuacuaaaccacgaggaagagagguagcguuuucuccugagcgugaagccggc
uuucuggcguugcuuggcugcaacugccgucagccauugaugaucguucuucucuccguauuggggagugagagggagag
aacgcggucugaguggu
The query sequence (length=177) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7mqa:L2 | 177 | 177 | 1.0000 | 1.0000 | 1.0000 | 8.74e-91 | |
| 2 | 7mq8:L2 | 215 | 145 | 0.8192 | 0.6744 | 1.0000 | 5.38e-73 | 7mq9:L2 |
umich.edu