gacgcgaccgaaauggugaaggacggguccagugcgagacccgcacuguugaguagagugugagcuccguaacuggucgc
guc
The query sequence (length=83) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6b3k:R | 83 | 83 | 1.0000 | 1.0000 | 1.0000 | 6.41e-39 | |
| 2 | 4kzd:R | 84 | 83 | 0.9759 | 0.9643 | 0.9759 | 1.39e-35 | 4kze:R, 4q9q:R, 4q9r:R |
| 3 | 6b14:R | 83 | 83 | 0.9759 | 0.9759 | 0.9759 | 1.39e-35 |
umich.edu