gaaucucuuugccuuuuggcuuagaucaaguguaguaucuguucuuuucaguguaacaacugaaaugaccucaaugaggc
u
The query sequence (length=81) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5lqw:2 | 81 | 81 | 1.0000 | 1.0000 | 1.0000 | 8.04e-38 | |
2 | 7dco:H | 169 | 71 | 0.8765 | 0.4201 | 1.0000 | 2.91e-32 | |
3 | 6j6q:L | 210 | 81 | 0.9506 | 0.3667 | 0.9506 | 4.87e-30 | |
4 | 6j6h:L | 209 | 81 | 0.9506 | 0.3684 | 0.9506 | 4.87e-30 | |
5 | 5gm6:L | 66 | 64 | 0.7901 | 0.9697 | 1.0000 | 2.27e-28 | |
6 | 6j6g:L | 208 | 81 | 0.9383 | 0.3654 | 0.9383 | 8.15e-28 | |
7 | 5mq0:2 | 155 | 71 | 0.8148 | 0.4258 | 0.9296 | 2.95e-22 | |
8 | 5wsg:L | 91 | 50 | 0.6173 | 0.5495 | 1.0000 | 1.37e-20 | 5ylz:F |
9 | 5lj3:Z | 171 | 71 | 0.8025 | 0.3801 | 0.9155 | 1.37e-20 | 5lj5:Z |
10 | 6j6n:L | 205 | 81 | 0.8889 | 0.3512 | 0.8889 | 4.94e-20 | |
11 | 5gmk:L | 127 | 81 | 0.8889 | 0.5669 | 0.8889 | 4.94e-20 | |
12 | 5mps:2 | 49 | 47 | 0.5802 | 0.9592 | 1.0000 | 6.39e-19 | |
13 | 6exn:2 | 136 | 47 | 0.5802 | 0.3456 | 1.0000 | 6.39e-19 | |
14 | 6bk8:2 | 135 | 45 | 0.5556 | 0.3333 | 1.0000 | 8.27e-18 | |
15 | 7b9v:2 | 196 | 45 | 0.5556 | 0.2296 | 1.0000 | 8.27e-18 | |
16 | 5nrl:2 | 155 | 44 | 0.5432 | 0.2839 | 1.0000 | 2.97e-17 | |
17 | 6g90:2 | 143 | 44 | 0.5432 | 0.3077 | 1.0000 | 2.97e-17 | |
18 | 5zwo:H | 150 | 43 | 0.5309 | 0.2867 | 1.0000 | 1.07e-16 | |
19 | 5zwm:H | 206 | 43 | 0.5309 | 0.2087 | 1.0000 | 1.07e-16 | |
20 | 7oqb:2 | 143 | 43 | 0.5309 | 0.3007 | 1.0000 | 1.07e-16 | 7oqe:2 |
21 | 5y88:F | 82 | 41 | 0.5062 | 0.5000 | 1.0000 | 1.38e-15 | |
22 | 3jb9:P | 111 | 44 | 0.5309 | 0.3874 | 0.9773 | 4.98e-15 |