BioLiP

>rna
gaaucucuuugccuuuuggcuuagaucaaguguaguaucuguucuuguaacaacugaaaugaccuaggcucauuguuaca
auacacauuuuuuggggacgggaagaggagacgucgcgacccucgcagagucguucuugacuuggucgcuugauguuucu
ucuucccguuc

The query sequence (length=171) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5lj3:Z	171	171	1.0000	1.0000	1.0000	1.82e-87	5lj5:Z
2	7dco:H	169	180	0.9240	0.9349	0.8778	1.15e-49
3	5mq0:2	155	172	0.8889	0.9806	0.8837	4.14e-49
4	6g90:2	143	152	0.7895	0.9441	0.8882	1.50e-43
5	5nrl:2	155	153	0.7895	0.8710	0.8824	1.94e-42
6	7oqb:2	143	150	0.7719	0.9231	0.8800	2.51e-41	7oqe:2
7	6j6n:L	205	205	0.9825	0.8195	0.8195	1.18e-34
8	5zwo:H	150	152	0.7602	0.8667	0.8553	4.23e-34
9	6j6g:L	208	208	0.9883	0.8125	0.8125	7.08e-32
10	6j6h:L	209	209	0.9883	0.8086	0.8086	9.16e-31
11	6j6q:L	210	210	0.9883	0.8048	0.8048	4.26e-29
12	5gmk:L	127	101	0.5322	0.7165	0.9010	4.26e-29
13	6bk8:2	135	76	0.4269	0.5407	0.9605	1.53e-28
14	6bk8:2	135	56	0.3216	0.4074	0.9821	2.58e-21
15	7b9v:2	196	94	0.4971	0.4337	0.9043	1.53e-28
16	5zwm:H	206	64	0.3626	0.3010	0.9688	4.29e-24
17	5zwm:H	206	51	0.2632	0.2184	0.8824	4.38e-09
18	6exn:2	136	135	0.6491	0.8162	0.8222	9.29e-21
19	6exn:2	136	28	0.1637	0.2059	1.0000	5.67e-08
20	5lqw:2	81	71	0.3801	0.8025	0.9155	3.34e-20
21	5wsg:L	91	53	0.2982	0.5604	0.9623	5.59e-18	5ylz:F
22	5mps:2	49	46	0.2690	0.9388	1.0000	5.59e-18
23	5gm6:L	66	46	0.2690	0.6970	1.0000	5.59e-18
24	3jb9:P	111	46	0.2632	0.4054	0.9783	9.35e-16
25	5y88:F	82	41	0.2398	0.5000	1.0000	3.36e-15

[Back]