BioLiP

>rna
gaaucucuuugaguguaguaucuguucuuuucaguguaacaacugaaaugaccuaggcucauacauuuuuuggcacggac
gggaagaggguggcgcugcaagaggaaguuuuucgauuguugauuuuccuuuugaaguguccucgagacgucgcgacccu
cggagucguucuugacuuggucgcuugauguuucuucuucccguuc

The query sequence (length=206) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5zwm:H	206	206	1.0000	1.0000	1.0000	7.84e-107
2	5zwo:H	150	89	0.4320	0.5933	1.0000	8.60e-42
3	5zwo:H	150	62	0.3010	0.4133	1.0000	8.78e-27
4	5nrl:2	155	92	0.4272	0.5677	0.9565	1.12e-35
5	5nrl:2	155	65	0.3010	0.4000	0.9538	2.46e-22
6	7dco:H	169	78	0.3786	0.4615	1.0000	1.12e-35
7	7dco:H	169	62	0.3010	0.3669	1.0000	8.78e-27
8	6g90:2	143	80	0.3738	0.5385	0.9625	1.13e-30
9	6g90:2	143	64	0.3010	0.4336	0.9688	5.28e-24
10	7oqb:2	143	81	0.3689	0.5315	0.9383	2.44e-27	7oqe:2
11	7oqb:2	143	64	0.3010	0.4336	0.9688	5.28e-24	7oqe:2
12	5lj3:Z	171	64	0.3010	0.3626	0.9688	5.28e-24	5lj5:Z
13	5lj3:Z	171	51	0.2184	0.2632	0.8824	5.40e-09	5lj5:Z
14	5mq0:2	155	62	0.2913	0.3871	0.9677	6.84e-23
15	5mq0:2	155	51	0.2233	0.2968	0.9020	1.16e-10
16	6bk8:2	135	62	0.2913	0.4444	0.9677	6.84e-23
17	5lqw:2	81	43	0.2087	0.5309	1.0000	3.20e-16
18	6j6q:L	210	55	0.2427	0.2381	0.9091	6.93e-13
19	6j6h:L	209	43	0.1990	0.1962	0.9535	2.49e-12
20	5gm6:L	66	36	0.1748	0.5455	1.0000	2.49e-12
21	6exn:2	136	28	0.1359	0.2059	1.0000	6.98e-08

[Back]