cuguggaaaugcgaaacacuugccaggugacccauccauccucccacggugagcuuucuuuucaccauaauccacuuggg
ccucucgacuucucgcguuacucggagcgggggcucaagauugaaaaaugcagcucacccuacguacuguugugaguucg
gcgcauuaaagcaaaaaccugggguguu
The query sequence (length=188) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8ova:BE | 188 | 188 | 1.0000 | 1.0000 | 1.0000 | 7.18e-97 | |
2 | 8rxh:L3 | 183 | 186 | 0.8777 | 0.9016 | 0.8871 | 4.54e-59 | 8rxx:L3 |
3 | 4v8m:BE | 210 | 210 | 0.9734 | 0.8714 | 0.8714 | 2.73e-56 | |
4 | 8ove:BE | 166 | 170 | 0.8191 | 0.9277 | 0.9059 | 9.83e-56 | |
5 | 6az3:3 | 177 | 186 | 0.8723 | 0.9266 | 0.8817 | 9.83e-56 | |
6 | 5t2a:E | 169 | 185 | 0.8457 | 0.9408 | 0.8595 | 2.14e-47 | |
7 | 8a98:3 | 161 | 165 | 0.7500 | 0.8758 | 0.8545 | 1.30e-39 | |
8 | 8ovj:3 | 156 | 112 | 0.5372 | 0.6474 | 0.9018 | 1.01e-35 | |
9 | 5t5h:E | 146 | 112 | 0.5266 | 0.6781 | 0.8839 | 1.02e-30 | |
10 | 8a3w:3 | 153 | 112 | 0.5213 | 0.6405 | 0.8750 | 1.32e-29 | |
11 | 3jcs:3 | 184 | 179 | 0.7394 | 0.7554 | 0.7765 | 4.81e-19 |