BioLiP

>rna
cuggugacuauagcaaggaggucacaccuguucccaugccgaacacagaaguuaagcuccuuagcgucgaugguagucga
acuuacguuccgcuagaguagaacguugccagg

The query sequence (length=113) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6s0z:B	114	113	1.0000	0.9912	1.0000	1.98e-55
2	7nhl:B	113	113	1.0000	1.0000	1.0000	1.98e-55	7nhm:B, 8p2f:B, 8p2g:B, 8p2h:B, 7p48:B
3	7asm:B	115	113	1.0000	0.9826	1.0000	1.98e-55	6fxc:AB, 6fxc:BB, 6hma:B, 5ngm:AB, 6s0x:B, 6s12:B, 6s13:B, 8y36:B, 8y37:B, 8y38:B, 8y39:B, 6yef:B
4	7ttu:2	111	109	0.9646	0.9820	1.0000	3.32e-53	7ttw:2
5	6sj6:B	112	113	0.9912	1.0000	0.9912	3.32e-53
6	5t7v:C	114	113	0.9823	0.9737	0.9823	1.54e-51
7	6ddd:2	104	104	0.9204	1.0000	1.0000	2.00e-50	6ddg:2
8	6wru:2	112	113	0.9735	0.9821	0.9735	7.18e-50
9	6wqn:2	111	112	0.9646	0.9820	0.9732	2.58e-49	6wqq:2, 6wrs:2
10	7aso:C	114	113	0.9558	0.9474	0.9558	1.55e-46	7asp:3, 5hkv:Y, 5hl7:Y, 5li0:B, 5nd8:B, 5nd9:B, 5nrg:Y, 5tcu:C, 4wce:Y, 4wf9:Y, 4wfa:Y, 4wfb:Y
11	7asn:B	106	102	0.8761	0.9340	0.9706	3.36e-43
12	6o8w:B	116	80	0.6195	0.6034	0.8750	7.49e-20	6o8x:B, 6o8y:B, 6o8z:B, 6o90:B, 6w6p:B, 6wu9:B
13	7nhk:B	114	80	0.6195	0.6140	0.8750	7.49e-20	7p7q:B, 7p7r:B, 7p7s:B, 7p7t:B, 7p7u:B

[Back]