BioLiP

>rna
cuggugacuauagcaaggaggucacaccuguucccaugccgaacacagaaguuaagcuccuuagcgacgaugguagucca
acuuacguuccgcuagaguagaacguuccagg

The query sequence (length=112) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6wru:2	112	112	1.0000	1.0000	1.0000	7.05e-55
2	6wqn:2	111	111	0.9911	1.0000	1.0000	2.54e-54	6wqq:2, 6wrs:2
3	5t7v:C	114	113	0.9911	0.9737	0.9823	1.53e-51
4	6s0z:B	114	113	0.9821	0.9649	0.9735	7.10e-50
5	7nhl:B	113	113	0.9821	0.9735	0.9735	7.10e-50	7nhm:B, 8p2f:B, 8p2g:B, 8p2h:B, 7p48:B
6	7asm:B	115	113	0.9821	0.9565	0.9735	7.10e-50	6fxc:AB, 6fxc:BB, 6hma:B, 5ngm:AB, 6s0x:B, 6s12:B, 6s13:B, 8y36:B, 8y37:B, 8y38:B, 8y39:B, 6yef:B
7	7ttu:2	111	107	0.9375	0.9459	0.9813	9.19e-49	7ttw:2
8	6sj6:B	112	113	0.9732	0.9732	0.9646	3.31e-48
9	7aso:C	114	113	0.9732	0.9561	0.9646	3.31e-48	7asp:3, 5hkv:Y, 5hl7:Y, 5li0:B, 5nd8:B, 5nd9:B, 5nrg:Y, 5tcu:C, 4wce:Y, 4wf9:Y, 4wfa:Y, 4wfb:Y
10	6ddd:2	104	104	0.9107	0.9808	0.9808	4.28e-47	6ddg:2
11	7asn:B	106	102	0.8571	0.9057	0.9412	3.35e-38
12	6o8w:B	116	76	0.5982	0.5776	0.8816	7.41e-20	6o8x:B, 6o8y:B, 6o8z:B, 6o90:B, 6w6p:B, 6wu9:B
13	7nhk:B	114	76	0.5982	0.5877	0.8816	7.41e-20	7p7q:B, 7p7r:B, 7p7s:B, 7p7t:B, 7p7u:B

[Back]