cggcgaguagcgcagcuugguagcgcaacugguuugggaccagugggucggagguucgaauccucucucgccgacca
The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7k50:7 | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 1.26e-35 | 7k51:5, 7k52:5, 7k54:5, 7k55:5, 8qbt:5, 8qbt:6, 8qoa:Y, 7ss9:5, 7ssd:5, 7ssl:5, 7sso:5, 7ssw:5, 7st2:5, 7st6:5 |
2 | 7st7:5 | 76 | 76 | 0.9870 | 1.0000 | 1.0000 | 4.53e-35 |