cggccuccgaacgguaagagccuagcauguagaacugaugaugucauacuuauccugucccuuuuuuuucca
The query sequence (length=72) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8i0s:G | 72 | 72 | 1.0000 | 1.0000 | 1.0000 | 6.92e-33 | 8i0t:G |
2 | 8i0r:G | 71 | 71 | 0.9861 | 1.0000 | 1.0000 | 2.49e-32 | |
3 | 8ch6:g | 76 | 75 | 1.0000 | 0.9474 | 0.9600 | 1.94e-28 | 7qtt:g |
4 | 8i0u:G | 79 | 79 | 1.0000 | 0.9114 | 0.9114 | 7.02e-23 | 8i0v:G |
5 | 8i0p:G | 63 | 67 | 0.8750 | 1.0000 | 0.9403 | 2.52e-22 | |
6 | 5z56:G | 77 | 77 | 0.9722 | 0.9091 | 0.9091 | 9.08e-22 | 5z57:G, 5z58:G |
7 | 6ahd:G | 77 | 77 | 0.9722 | 0.9091 | 0.9091 | 9.08e-22 | |
8 | 7abi:Z | 57 | 61 | 0.7917 | 1.0000 | 0.9344 | 5.46e-19 | |
9 | 5yzg:G | 88 | 37 | 0.5139 | 0.4205 | 1.0000 | 1.98e-13 | |
10 | 5xjc:G | 84 | 37 | 0.5139 | 0.4405 | 1.0000 | 1.98e-13 | |
11 | 7abg:Z | 47 | 51 | 0.6528 | 1.0000 | 0.9216 | 1.98e-13 | |
12 | 6icz:G | 84 | 36 | 0.5000 | 0.4286 | 1.0000 | 7.12e-13 | |
13 | 8qo9:Z | 46 | 51 | 0.6389 | 1.0000 | 0.9020 | 3.31e-11 | |
14 | 8q7n:Z | 31 | 31 | 0.4306 | 1.0000 | 1.0000 | 4.28e-10 | |
15 | 7aav:Z | 29 | 29 | 0.4028 | 1.0000 | 1.0000 | 5.54e-09 | 7abf:Z |