cggccuccgaacgguaagagccuagcauguagaacugaugaugucauacuuauccugucccuuuuuuuucc
The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8i0s:G | 72 | 71 | 1.0000 | 0.9861 | 1.0000 | 2.44e-32 | 8i0t:G |
2 | 8i0r:G | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 2.44e-32 | |
3 | 8ch6:g | 76 | 74 | 1.0000 | 0.9342 | 0.9595 | 6.84e-28 | 7qtt:g |
4 | 8i0u:G | 79 | 78 | 1.0000 | 0.8987 | 0.9103 | 2.48e-22 | 8i0v:G |
5 | 8i0p:G | 63 | 67 | 0.8873 | 1.0000 | 0.9403 | 2.48e-22 | |
6 | 5z56:G | 77 | 77 | 0.9859 | 0.9091 | 0.9091 | 8.91e-22 | 5z57:G, 5z58:G |
7 | 6ahd:G | 77 | 77 | 0.9859 | 0.9091 | 0.9091 | 8.91e-22 | |
8 | 7abi:Z | 57 | 61 | 0.8028 | 1.0000 | 0.9344 | 5.36e-19 | |
9 | 5yzg:G | 88 | 37 | 0.5211 | 0.4205 | 1.0000 | 1.94e-13 | |
10 | 5xjc:G | 84 | 37 | 0.5211 | 0.4405 | 1.0000 | 1.94e-13 | |
11 | 7abg:Z | 47 | 51 | 0.6620 | 1.0000 | 0.9216 | 1.94e-13 | |
12 | 6icz:G | 84 | 36 | 0.5070 | 0.4286 | 1.0000 | 6.98e-13 | |
13 | 8qo9:Z | 46 | 51 | 0.6479 | 1.0000 | 0.9020 | 3.25e-11 | |
14 | 8q7n:Z | 31 | 31 | 0.4366 | 1.0000 | 1.0000 | 4.20e-10 | |
15 | 7aav:Z | 29 | 29 | 0.4085 | 1.0000 | 1.0000 | 5.44e-09 | 7abf:Z |