cggcacguagcgcagccugguagcgcaccgucauggggugucgggggucggagguucaaauccucucgugccgacca
The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4v5h:AV | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 1.26e-35 | 4v6m:AV |
| 2 | 7oiz:V | 75 | 77 | 0.9740 | 1.0000 | 0.9740 | 9.80e-32 | 7oj0:V, 7p3k:V |
| 3 | 3jbu:v | 76 | 77 | 0.9610 | 0.9737 | 0.9610 | 4.56e-30 | 5np6:B |
| 4 | 3jbv:W | 75 | 75 | 0.9351 | 0.9600 | 0.9600 | 5.90e-29 |
umich.edu