ccuucgauagcucaguugguagagcggaggacuguagauccuuaggucgcugguucgauuccggcucgaaggacca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8jdl:B | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 7y7g:V, 7y7h:V |
| 2 | 8jdm:B | 73 | 76 | 0.9605 | 1.0000 | 0.9605 | 5.79e-29 | 8jdm:C |
umich.edu