ccugcggcggccgcaggaagaggaacggagcgaguccccgcggcgcgauucccugagcugugggacgugcacccaggacu
cggcucacacau
The query sequence (length=92) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7bgb:B | 92 | 92 | 1.0000 | 1.0000 | 1.0000 | 7.26e-44 | 7trc:B |
| 2 | 8oue:B | 92 | 92 | 0.9783 | 0.9783 | 0.9783 | 5.66e-40 | |
| 3 | 7v9a:R | 146 | 88 | 0.9130 | 0.5753 | 0.9545 | 7.37e-34 | |
| 4 | 8ouf:B | 86 | 92 | 0.9239 | 0.9884 | 0.9239 | 5.74e-30 |
umich.edu