ccgugauaguuuaauggucagaaugggcgcuugucgcgugccagaucgggguucaauuccccgucgcgga
The query sequence (length=70) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 1il2:D | 70 | 70 | 1.0000 | 1.0000 | 1.0000 | 8.61e-32 | |
| 2 | 1asy:R | 75 | 70 | 1.0000 | 0.9333 | 1.0000 | 8.61e-32 | 1asy:S, 1asz:R, 1asz:S, 1il2:C, 3j16:L, 4v6i:CB |
umich.edu