ccgcuucaccaaaagcugucccuuaggggauagaacuugagugaaggugggcugcuugcaucagccuaaugucgagaagu
gcuuucuucggaaaguaacccucgaaacaaauucauuuagacgaaugaaggaaugcaacaguug
The query sequence (length=144) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7l48:E | 144 | 144 | 1.0000 | 1.0000 | 1.0000 | 1.53e-72 | |
| 2 | 7l49:E | 135 | 108 | 0.7500 | 0.8000 | 1.0000 | 1.57e-52 | |
| 3 | 7c7l:C | 116 | 74 | 0.5139 | 0.6379 | 1.0000 | 1.25e-33 |
umich.edu