cccuuagcgagagguccucuggauguuguuucggcauccugcauugaaucugaguuac
The query sequence (length=58) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7v9u:G | 58 | 58 | 1.0000 | 1.0000 | 1.0000 | 3.17e-25 | 7v9x:E, 7v9x:H, 7xjg:E, 7xjg:H |
| 2 | 7v9u:E | 57 | 57 | 0.9828 | 1.0000 | 1.0000 | 1.14e-24 |
umich.edu