ccccucccgggagagccauaguggucugcggaaccggugaguacaccggaauugcgagauuugggcgugcccccgcgaga
cugcuagccgaguaguguugggucgcgaaaggccuugugguacugccugauagggugcuugcgagugccccgggaggucu
cgu
The query sequence (length=163) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6ip6:zz | 163 | 163 | 1.0000 | 1.0000 | 1.0000 | 4.83e-83 | 6ip8:zz |
2 | 5oa3:3 | 186 | 163 | 0.9939 | 0.8710 | 0.9939 | 2.25e-81 | |
3 | 5a2q:3 | 257 | 163 | 0.9939 | 0.6304 | 0.9939 | 2.25e-81 | |
4 | 4ujc:AC | 261 | 163 | 0.9632 | 0.6015 | 0.9632 | 2.28e-71 | 4ujd:BC |
5 | 7syv:z | 258 | 163 | 0.9632 | 0.6085 | 0.9632 | 2.28e-71 | |
6 | 7syr:z | 188 | 163 | 0.9632 | 0.8351 | 0.9632 | 2.28e-71 | 7sys:z, 7syt:z, 7syu:z, 7syw:z, 7syx:z |
7 | 7syp:z | 249 | 163 | 0.9632 | 0.6305 | 0.9632 | 2.28e-71 | |
8 | 7syo:z | 166 | 163 | 0.9632 | 0.9458 | 0.9632 | 2.28e-71 | |
9 | 7syg:z | 162 | 163 | 0.9632 | 0.9691 | 0.9632 | 2.28e-71 | 7syh:z, 7syi:z, 7syj:z, 7syk:z, 7syl:z, 7sym:z, 7syn:z |
10 | 5flx:z | 264 | 163 | 0.9632 | 0.5947 | 0.9632 | 2.28e-71 | 7syq:z |