cccccccucccgggagagccauaguggucugcggaaccggugaguacaccggaaugauuugggcgugcccccgcaagacu
gcuagccgaguaguguugggucgcgaaaggccuugugguacugccugauagggugcuugcgagugccccgggaggucucg
ua
The query sequence (length=162) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 4ujc:AC | 261 | 162 | 1.0000 | 0.6207 | 1.0000 | 1.72e-82 | 4ujd:BC |
2 | 7syv:z | 258 | 162 | 1.0000 | 0.6279 | 1.0000 | 1.72e-82 | |
3 | 7syr:z | 188 | 162 | 1.0000 | 0.8617 | 1.0000 | 1.72e-82 | 7sys:z, 7syt:z, 7syu:z, 7syw:z, 7syx:z |
4 | 7syp:z | 249 | 162 | 1.0000 | 0.6506 | 1.0000 | 1.72e-82 | |
5 | 7syo:z | 166 | 162 | 1.0000 | 0.9759 | 1.0000 | 1.72e-82 | |
6 | 7syg:z | 162 | 162 | 1.0000 | 1.0000 | 1.0000 | 1.72e-82 | 7syh:z, 7syi:z, 7syj:z, 7syk:z, 7syl:z, 7sym:z, 7syn:z |
7 | 5flx:z | 264 | 162 | 1.0000 | 0.6136 | 1.0000 | 1.72e-82 | 7syq:z |
8 | 5oa3:3 | 186 | 167 | 1.0000 | 0.8710 | 0.9701 | 2.91e-75 | |
9 | 5a2q:3 | 257 | 167 | 1.0000 | 0.6304 | 0.9701 | 2.91e-75 | |
10 | 6ip6:zz | 163 | 163 | 0.9691 | 0.9632 | 0.9632 | 2.26e-71 | 6ip8:zz |