Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
cccauguuaauagcuucuuaggagaaugacguagcaugcuacg

The query sequence (length=43) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 7rdy:T 44 43 1.0000 0.9773 1.0000 4.32e-17
2 7krn:T 43 43 1.0000 1.0000 1.0000 4.32e-17 7kro:T
3 7rdx:T 46 40 0.9070 0.8478 0.9750 9.35e-14
4 7rdz:T 37 36 0.8372 0.9730 1.0000 3.36e-13 7re0:T, 7re1:T, 7re2:T, 7re3:T, 7re3:U
5 7krp:T 36 36 0.8372 1.0000 1.0000 3.36e-13
6 6xez:T 36 35 0.8140 0.9722 1.0000 1.21e-12
7 7rdx:P 34 33 0.7674 0.9706 1.0000 1.57e-11 7rdy:P, 7rdz:P, 7re0:P, 7re1:P, 7re2:P, 7re3:P, 7re3:Q, 6xez:P
8 7krn:P 37 33 0.7674 0.8919 1.0000 1.57e-11 7kro:P, 7krp:P
9 7uo4:T 36 32 0.7442 0.8889 1.0000 5.63e-11
10 7uo4:P 34 32 0.7442 0.9412 1.0000 5.63e-11
11 7uo7:T 34 31 0.7209 0.9118 1.0000 2.02e-10
12 7uo7:P 32 31 0.7209 0.9688 1.0000 2.02e-10

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218