ccaugguguaaugguuagcacucuggacuuugaauccagcgauccgaguucaaaucucggugg
The query sequence (length=63) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8pu0:X | 71 | 63 | 1.0000 | 0.8873 | 1.0000 | 5.79e-28 | |
| 2 | 9enc:D | 75 | 63 | 1.0000 | 0.8400 | 1.0000 | 5.79e-28 | 8ptx:X, 8ptz:X |
| 3 | 9enb:C | 72 | 63 | 1.0000 | 0.8750 | 1.0000 | 5.79e-28 | 9enb:D |
| 4 | 8c8h:U | 63 | 63 | 1.0000 | 1.0000 | 1.0000 | 5.79e-28 | 6rfl:U |
| 5 | 8okd:C | 70 | 63 | 0.9206 | 0.8286 | 0.9206 | 5.87e-18 | 8okd:X |
umich.edu