cauagcccagcuuggcgggcgaaggccaagacggagaugaggugcgc
The query sequence (length=47) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8hio:B | 47 | 47 | 1.0000 | 1.0000 | 1.0000 | 3.00e-19 | |
| 2 | 8hhl:B | 49 | 44 | 0.9362 | 0.8980 | 1.0000 | 1.39e-17 | |
| 3 | 8hhm:B | 40 | 40 | 0.8511 | 1.0000 | 1.0000 | 2.33e-15 |
umich.edu