cacgccccgccggcggaugccucggcccgggcggcgacgaagagcgcggcggagcgcgagacgcggugcggacccgcccg
ccccgagaagcaccgauccucgaacgcagcgcgccccggcgccgccgccucggcgccugc
The query sequence (length=140) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8bsj:LD | 140 | 140 | 1.0000 | 1.0000 | 1.0000 | 2.47e-70 | |
2 | 8br8:LD | 142 | 140 | 1.0000 | 0.9859 | 1.0000 | 2.47e-70 | 8brm:LD, 8btd:LD, 8btr:LD |
3 | 8bsi:LD | 137 | 139 | 0.9786 | 1.0000 | 0.9856 | 6.92e-66 | |
4 | 7pwg:4 | 138 | 136 | 0.9571 | 0.9710 | 0.9853 | 3.22e-64 | 7pwo:42 |
5 | 8fru:4 | 141 | 140 | 0.9714 | 0.9645 | 0.9714 | 4.17e-63 |