BioLiP

>rna
caacuccguggaagccguaauggcaggaagcgga

The query sequence (length=34) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	1ysh:F	34	34	1.0000	1.0000	1.0000	2.96e-12
2	4v9f:0	2808	34	1.0000	0.0121	1.0000	2.96e-12
3	4v4b:B3	2863	34	1.0000	0.0119	1.0000	2.96e-12
4	2qa4:0	2753	34	1.0000	0.0124	1.0000	2.96e-12
5	3ow2:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
6	2j37:Z	280	34	1.0000	0.1214	1.0000	2.96e-12
7	3i56:0	2754	34	1.0000	0.0123	1.0000	2.96e-12	1yhq:0, 1yi2:0, 1yij:0, 1yjn:0, 1yjw:0
8	1ffk:0	2706	34	1.0000	0.0126	1.0000	2.96e-12
9	3cxc:0	2754	34	1.0000	0.0123	1.0000	2.96e-12	1jj2:0, 1k73:A, 1k8a:A, 1k9m:A, 1kc8:A, 1kd1:A, 1kqs:0, 1m1k:A, 1m90:A, 1n8r:A, 1nji:A, 2otj:0, 2otl:0, 1q7y:A, 1q81:A, 1q82:A, 1q86:A, 2qex:0, 1qvf:0, 1qvg:0, 1s72:0, 1vq4:0, 1vq5:0, 1vq6:0, 1vq7:0, 1vq8:0, 1vq9:0, 1vqk:0, 1vql:0, 1vqm:0, 1vqn:0, 1vqo:0, 1vqp:0, 1w2b:0
10	3cpw:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
11	3ccv:0	2754	34	1.0000	0.0123	1.0000	2.96e-12	3cd6:0
12	3ccu:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
13	3ccs:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
14	3ccr:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
15	3ccq:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
16	3ccm:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
17	3ccl:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
18	3ccj:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
19	3cce:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
20	3cc7:0	2754	34	1.0000	0.0123	1.0000	2.96e-12
21	3cc2:0	2754	34	1.0000	0.0123	1.0000	2.96e-12	3cc4:0, 3cma:0, 3cme:0, 3g4s:0, 3g6e:0, 3g71:0, 3i55:0, 1yit:0, 1yj9:0

[Back]