caacaacaacaacaaggauccaaaacagacc
The query sequence (length=31) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8rg0:7 | 31 | 31 | 1.0000 | 1.0000 | 1.0000 | 1.14e-10 | |
| 2 | 8pj5:7 | 56 | 31 | 1.0000 | 0.5536 | 1.0000 | 1.14e-10 | 8pj6:7 |
| 3 | 8pj2:7 | 57 | 31 | 1.0000 | 0.5439 | 1.0000 | 1.14e-10 | 8pj3:7, 8pj4:7 |
| 4 | 8pj1:7 | 47 | 31 | 1.0000 | 0.6596 | 1.0000 | 1.14e-10 |
umich.edu