auuuaggugauuugcuaccuuuaagugcagcuagaaa
The query sequence (length=37) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7d8o:B | 37 | 37 | 1.0000 | 1.0000 | 1.0000 | 7.11e-14 | 7d8o:D, 7d8o:F, 7d8o:H, 7d8o:J, 7d8o:L |
| 2 | 2xd0:G | 36 | 36 | 0.9459 | 0.9722 | 0.9722 | 1.19e-11 | 2xd0:H, 2xd0:I, 2xd0:U, 2xd0:V, 2xd0:W, 2xdb:G, 2xdd:F, 2xdd:G, 2xdd:H |
umich.edu