auugaaaguuguaguaugcgguccuugcggcugagagcacuucaggaguugcccgcgccagc
The query sequence (length=62) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7r21:R | 62 | 62 | 1.0000 | 1.0000 | 1.0000 | 2.08e-27 | |
| 2 | 7r2k:U | 57 | 57 | 0.9194 | 1.0000 | 1.0000 | 1.25e-24 | |
| 3 | 3x1l:I | 32 | 32 | 0.5161 | 1.0000 | 1.0000 | 9.91e-11 |
umich.edu