auugaaacagggucagcuugccguagguggcaucgcccucgu
The query sequence (length=42) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8g9s:O | 42 | 42 | 1.0000 | 1.0000 | 1.0000 | 1.49e-16 | |
| 2 | 8g9u:K | 43 | 41 | 0.9762 | 0.9535 | 1.0000 | 5.37e-16 | 8gaf:K, 8gam:K, 8gan:K |
| 3 | 8g9t:O | 43 | 39 | 0.9286 | 0.9070 | 1.0000 | 6.94e-15 |
umich.edu