auucucucuuugccuuuuggcuuagaucaaguguaguaucuguaucuuguuuuugguuuuuggaaagccucugggcuaug
cuuuccucuugcuauugcacuacuggcaagc
The query sequence (length=111) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 3jb9:P | 111 | 111 | 1.0000 | 1.0000 | 1.0000 | 2.51e-54 | |
2 | 5lj3:Z | 171 | 46 | 0.4054 | 0.2632 | 0.9783 | 5.71e-16 | 5lj5:Z |
3 | 7b9v:2 | 196 | 46 | 0.4054 | 0.2296 | 0.9783 | 5.71e-16 | |
4 | 5wsg:L | 91 | 44 | 0.3874 | 0.4725 | 0.9773 | 7.38e-15 | 5ylz:F |
5 | 5mq0:2 | 155 | 44 | 0.3874 | 0.2774 | 0.9773 | 7.38e-15 | |
6 | 5mps:2 | 49 | 44 | 0.3874 | 0.8776 | 0.9773 | 7.38e-15 | |
7 | 5lqw:2 | 81 | 44 | 0.3874 | 0.5309 | 0.9773 | 7.38e-15 | |
8 | 6j6q:L | 210 | 44 | 0.3874 | 0.2048 | 0.9773 | 7.38e-15 | |
9 | 6j6h:L | 209 | 44 | 0.3874 | 0.2057 | 0.9773 | 7.38e-15 | |
10 | 6j6g:L | 208 | 44 | 0.3874 | 0.2067 | 0.9773 | 7.38e-15 | |
11 | 5gmk:L | 127 | 44 | 0.3874 | 0.3386 | 0.9773 | 7.38e-15 | |
12 | 5gm6:L | 66 | 44 | 0.3874 | 0.6515 | 0.9773 | 7.38e-15 | |
13 | 6exn:2 | 136 | 44 | 0.3874 | 0.3162 | 0.9773 | 7.38e-15 | |
14 | 7dco:H | 169 | 44 | 0.3874 | 0.2544 | 0.9773 | 7.38e-15 | |
15 | 6j6n:L | 205 | 39 | 0.3514 | 0.1902 | 1.0000 | 2.66e-14 | |
16 | 6bk8:2 | 135 | 43 | 0.3784 | 0.3111 | 0.9767 | 2.66e-14 | |
17 | 5y88:F | 82 | 52 | 0.4324 | 0.5854 | 0.9231 | 9.55e-14 |