aucguagccaaugagguuuauccgaggcgcgau
The query sequence (length=33) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6qw6:4 | 125 | 33 | 1.0000 | 0.2640 | 1.0000 | 1.00e-11 | 6qx9:4 |
| 2 | 8q7n:4 | 76 | 33 | 1.0000 | 0.4342 | 1.0000 | 1.00e-11 | |
| 3 | 2ozb:C | 33 | 33 | 1.0000 | 1.0000 | 1.0000 | 1.00e-11 | 2ozb:F |
| 4 | 5o9z:4 | 137 | 33 | 1.0000 | 0.2409 | 1.0000 | 1.00e-11 |
umich.edu